View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_low_28 (Length: 330)
Name: NF15554_low_28
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 109 - 321
Target Start/End: Original strand, 6896813 - 6897023
Alignment:
| Q |
109 |
taatagcatatttctaattaataatgtttgctaaaaaacacaaaatattatatgtatattaannnnnnnnnnnnnnnnaaaatggctactataagatgct |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
6896813 |
taatatcatatttctaattaataatgtttgctaaaaaaaccaaaaaattatatgtatattaatttttattttttttt--aaatggctactataggatgct |
6896910 |
T |
|
| Q |
209 |
agagagaggggaatccctttatttttaatgctttcttcagcaattttgcagtgcgttaattgttactttaaatagaaaatttagattaaatgcaagtttg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||| || ||||||| || |
|
|
| T |
6896911 |
agagagaggggaatccctttatttttaatgctttcttcagcaattttgcagtgcattaattgttacttgaaatagaaaatgtagaccaattgcaagtgtg |
6897010 |
T |
|
| Q |
309 |
tgtagagtataat |
321 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6897011 |
tgtagagtataat |
6897023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 6896705 - 6896770
Alignment:
| Q |
1 |
agaagaaacattgaaagagaagaaagatgaacaactttgcagacaaggtggttgtttttcatggat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6896705 |
agaagaaacattgaaagagaagaaagatgaacaactttgcagacaaggtggttgcttttcatggat |
6896770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University