View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_low_49 (Length: 237)
Name: NF15554_low_49
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 42214693 - 42214477
Alignment:
| Q |
18 |
ctgagggtctttctgttaatgtcatcccagatacattgaagtttactaagttgcaccaagacctgtcatttaaggttgtcctgaagggccctccaatgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214693 |
ctgagggtctttctgttaatgtcatcccagatacattgaagtttactaagttgcaccaagacctgtcatttaaggttgtcctgaagggccctccaatgtc |
42214594 |
T |
|
| Q |
118 |
agatgagaaaataacattatctgcattacttgaatggaatgactctaaacacagtgtcagaagtccgatagttgtctttaagccaacattctgataccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214593 |
agatgagaaaataacattatctgcattacttgaatggaatgactctaaacacagtgtcagaagtccgatagttgtctttaagccaacattctgataccaa |
42214494 |
T |
|
| Q |
218 |
aaaccgtattggactta |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42214493 |
aaaccgtattggactta |
42214477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University