View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15555_high_6 (Length: 404)
Name: NF15555_high_6
Description: NF15555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15555_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 362
Target Start/End: Original strand, 36432092 - 36432453
Alignment:
| Q |
1 |
tcatcctcatccaaacctatgctaattgttcaacgcccctccgaacgaacaccgtcatggtcatcaccggcatcagataaattctaccattcagcgccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36432092 |
tcatcctcatccaaacctatgctaattgttcaacgcccctccgaacgaacaccgtcatggtcatcaccggcatcagataaattctaccattcagcgccaa |
36432191 |
T |
 |
| Q |
101 |
tgaacgttccaatgatgtcttcagctatggcgaaccgcgcgaggcgatacgaagaagaagatgcacgtgctttaaacgaggaagaggaatttcgaagcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36432192 |
tgaacgttccaatgatgtcttcagctatggcgaaccgcgcgaggcgatacgaagaagaagatgcacatgctttaaacgaggaagaggaatttcgaagcac |
36432291 |
T |
 |
| Q |
201 |
gatgccaccgcatgagtatctttcaaggcaagtggatttttcgccgatgcattcgtgttcgttgtttgaaggtgttggtagaaccctaaaaggaagagat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36432292 |
gatgccaccgcatgagtatctttcaaggcaagtagatttttcgccgatgcattcgtgttcgttgtttgaaggtgttggtagaaccctaaaaggaagagat |
36432391 |
T |
 |
| Q |
301 |
atgcgtcaagttaggaatgctgttttgagccaaacaggtttctttgattgaaagctactgaa |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36432392 |
atgcgtcaagttaggaatgctgttttgagccaaacaggtttctttgattgaaagctactgaa |
36432453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University