View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15555_low_13 (Length: 346)
Name: NF15555_low_13
Description: NF15555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15555_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 2184118 - 2184232
Alignment:
| Q |
7 |
ctttcctcatgtttctatggttgcttctcagggaataacaataggtagtttcacattttctcctattgagttatatacattggagtgattttaagttccg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2184118 |
ctttcctcatgtttctatggttgcttctcagggaataacaataggtagtttcacattttcttctattgagttatatacatttgagtgattttaagttccg |
2184217 |
T |
|
| Q |
107 |
atgccgtctatgaca |
121 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
2184218 |
atgccctctatgaca |
2184232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 118 - 328
Target Start/End: Original strand, 2184542 - 2184767
Alignment:
| Q |
118 |
gacaatattactctcttaatctaacggtttgtagccggatgcacgataaaaca---ttcaaaggatcgnnnnnnnnnnnnnagttatcaaagattgctgt |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| | ||||||||||||||| |
|
|
| T |
2184542 |
gacaattttactctcttaatctaacggtttgtagccggatgcacgataaaacagttttcacaggatcgattttgctttttaggctatcaaagattgctgc |
2184641 |
T |
|
| Q |
215 |
ttattattacaaa-taaactattccattcatgtttgatagacacaagtatgcattttaattagcagatt-----------attggaataatttacctcta |
302 |
Q |
| |
|
||||||||| || |||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2184642 |
ttattattagaacgtaaactcttccatacatgtttgatagacacaagtatgcattttaattagcagattaagttaacaccattggaataatttacctcta |
2184741 |
T |
|
| Q |
303 |
attgtttgtagattcaatggaggaat |
328 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2184742 |
attgtttgtagattcaatggaggaat |
2184767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University