View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15555_low_18 (Length: 286)
Name: NF15555_low_18
Description: NF15555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15555_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 45 - 276
Target Start/End: Original strand, 6791349 - 6791580
Alignment:
| Q |
45 |
atgttagcgagatactcataaaagacttggtcaggattgtccctgggataatgatgcctattgatcattttataaaagaaatttcaaagataactactat |
144 |
Q |
| |
|
|||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6791349 |
atgttagcaacatactcataaaagacttagtcaggattgtccctgggataatgatgcctattgatcattttataaaagaaatttcaaagataactactat |
6791448 |
T |
|
| Q |
145 |
gctctctgtaactaactcgctagaagccataactgcctcaccggggtaattttcagcaacggggttgaggcggttttatctgttgctcttgtagattttg |
244 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6791449 |
gctctctgtaactaactcgccagaagccgtaactgcctcaccggggtaattttcagcaacggggttgaggcggttttatctgttgctcttgtagattttg |
6791548 |
T |
|
| Q |
245 |
aatcgttttagttttctctatcccctcctttg |
276 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
6791549 |
aatcgttttagttttctctatcccatcctttg |
6791580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University