View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15555_low_8 (Length: 395)
Name: NF15555_low_8
Description: NF15555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15555_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 76 - 342
Target Start/End: Complemental strand, 33262320 - 33262054
Alignment:
| Q |
76 |
ttgataccttaaaatctgtacaatctcattctcagtggcgccagggggtcttgaactagctccatcaatgggtccattgactgaatgacccaaaatcatt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33262320 |
ttgataccttaaaatctgtacaatctcattctcagtggcgctagggggtcttgaactagctccatcaatgggtccatttactgaatgacccaaaatcatt |
33262221 |
T |
 |
| Q |
176 |
gagctcagctcttctgaagttgggatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaactagtcattgttgacccctcca |
275 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262220 |
gagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaactagtcattgttgacccctcca |
33262121 |
T |
 |
| Q |
276 |
atatggcagtttgtggttgcagatgactaattgctggcccttccaacatggcactctgtggttgcaa |
342 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
33262120 |
atatggcagttcgtggttgcagattactaattgatggcccttccaacatggcagtctgtggtagcaa |
33262054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 326 - 380
Target Start/End: Complemental strand, 33262025 - 33261971
Alignment:
| Q |
326 |
gcactctgtggttgcaactcagtcatcgctggcccttgcaatatcgctctctgtg |
380 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262025 |
gcactctgtggttccaactcagtcatcgctggcccttgcaatatcgctctctgtg |
33261971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 33262388 - 33262348
Alignment:
| Q |
8 |
tttataggtaaattactcgtaattcttcaaagataaactag |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33262388 |
tttataggtaaattactcgtaattcttcaaagataacctag |
33262348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University