View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15557_low_1 (Length: 411)
Name: NF15557_low_1
Description: NF15557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15557_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 112 - 400
Target Start/End: Original strand, 9498162 - 9498450
Alignment:
| Q |
112 |
caatactttgtaaacatgtgattggaagatgtattgatttttacaacaataatcacaagaacaagaaatctctcagtatgtcagacaattgacactactg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9498162 |
caatactttgtaaacatgtgattggaagatgtattgatttttacaacaataatctcaagaacaagaaatctttcagtatgtcagacaattgacactactg |
9498261 |
T |
 |
| Q |
212 |
tgtttttgtgccagcatgcagctaggtatcttgccaatcaggaatgggtaaaaaatgattctctgaaaatagtggaaaatactgctgtaatacctcttct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9498262 |
tgtttttgtgccagcatgcagctaggtatcttgccaatcaggaatgggtaaaaaatgattctctgaaaacagtggaaaatactgctgtaatacctcttct |
9498361 |
T |
 |
| Q |
312 |
cttggctgttaattgtcatttcaagtcatgtagtctacaccactcattcctagtaataacatctgtatccttcttgtatagatacctat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9498362 |
cttggctgttaattgtcatttcaagtcatgtagtctacaccactcattcctattaataacatctgtatccttcttgtatagatacctat |
9498450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University