View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15557_low_3 (Length: 237)
Name: NF15557_low_3
Description: NF15557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15557_low_3 |
 |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0169 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40741574 - 40741353
Alignment:
| Q |
1 |
atgaaaatttgccttactctatatatttatcgataaaaagtaaaagtgaatggttttccc------accactctatttgtaacacacaccccccatatta |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| ||||||||||| | ||| |||||| |
|
|
| T |
40741574 |
atgaaaatttgccttactctatatatttattaataaaaagtaaaagtcaatggttttccctttcccaccgctctatttgtacc------cccatatatta |
40741481 |
T |
 |
| Q |
95 |
atgaaagacaattaagaattt-cccctaaatttcttaaccacctaaatattaatttattgttgccaacaccgattgggtttatcccggatctattatgat |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40741480 |
atgaaagacaattaagaattttcccctaaatttcttaaccacctaaatattaatttattgttgccaacatcgattgggtttatcccggatctattatgat |
40741381 |
T |
 |
| Q |
194 |
gcagaaactagttggaaaaaattattat |
221 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |
|
|
| T |
40741380 |
gcagaaactagttgaaaaaaatcattat |
40741353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 40742093 - 40741959
Alignment:
| Q |
1 |
atgaaaatttgccttactctatatatttatcgataaaaagtaaaagtgaatggttttcccaccactctatttgtaacacacaccccccatattaatgaaa |
100 |
Q |
| |
|
||||||||||||| |||| ||||||| ||| ||||||||||||||| | |||||||||| | ||||||| ||| | |||| |||||||| ||| |
|
|
| T |
40742093 |
atgaaaatttgccctactatatatatatattaataaaaagtaaaagtcattggttttccc-ctactctatatgtttc------cccctatattaataaaa |
40742001 |
T |
 |
| Q |
101 |
gacaattaagaattt--cccctaaatttcttaaccacctaaa |
140 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40742000 |
gacgtttaagaattttccccctaaatttcttaaccacctaaa |
40741959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 13923932 - 13923973
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
13923932 |
ttatcccggatctattatgatgcataaattagttggaaaaaa |
13923973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 203
Target Start/End: Complemental strand, 7871599 - 7871569
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaacta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7871599 |
ttatcccggatctattatgatgcagaaacta |
7871569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 13988293 - 13988334
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
13988293 |
ttatcccggatctattatgatgcataaattatttggaaaaaa |
13988334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 153 - 214
Target Start/End: Complemental strand, 16445938 - 16445878
Alignment:
| Q |
153 |
gttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16445938 |
gttggcaataccgattgggtt-atcccggatctattatgatgcagaaactagttgaaaaaaa |
16445878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 215
Target Start/End: Complemental strand, 7912702 - 7912633
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
|||||||||||| ||| || | ||||||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7912702 |
aatttattgttggcaagactggttgggttg-tcccggatctattatgatgcataaactagttgaaaaaaat |
7912633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 26696643 - 26696711
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||| ||| || | ||||||| ||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
26696643 |
aatttattgttggcaagactggttgggttg-tcccggatctattatgatgcataaactagttgaaaaaaa |
26696711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 215
Target Start/End: Original strand, 43774423 - 43774492
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
|||||||||||| ||| || | ||||||| |||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43774423 |
aatttattgttggcaagactggttgggttg-tcccagatctattatgatgcataaactagttgaaaaaaat |
43774492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 22433399 - 22433440
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
22433399 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
22433440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 21292263 - 21292204
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagt |
205 |
Q |
| |
|
||||||| |||| ||| |||| ||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
21292263 |
aatttatcgttggcaagaccggttgggtt-atcccggatctattatgatgcataaattagt |
21292204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 26994771 - 26994812
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26994771 |
ttatcccggatctattatgatgcaaaaactagttggaaaaaa |
26994812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 215
Target Start/End: Original strand, 53979626 - 53979695
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
|||||||||||| ||| || | ||||||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
53979626 |
aatttattgttggcaagactggttgggttg-tcccggatctattatgatgcataaactagttgaaaaaaat |
53979695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 53527103 - 53527144
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
53527103 |
ttatcccggatctattgtgatgcagaaactagttgaaaaaaa |
53527144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 203
Target Start/End: Complemental strand, 2926628 - 2926598
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaacta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2926628 |
ttatcccggatctattatgatgcagaaacta |
2926598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 20195292 - 20195251
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
20195292 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
20195251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 110516 - 110556
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
110516 |
ttatcccggatctattatgatgcagaaactagttgaaaaaa |
110556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 215
Target Start/End: Complemental strand, 348405 - 348336
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
|||||||||||| ||| || | ||||||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
348405 |
aatttattgttggcaagactggttgggttg-tcccggatctattatgatgcataaactagttgaaaaaaat |
348336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 8507656 - 8507697
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
8507656 |
ttatcccggatctattatcatgcagaaactagttgaaaaaaa |
8507697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 34192395 - 34192437
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
34192395 |
ttatcccggatctattatgatgcataaactagttaaaaaaaat |
34192437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 24048366 - 24048325
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
24048366 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
24048325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 25496886 - 25496927
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
25496886 |
ttatcccggatctattatgatgcataaactatttggaaaaaa |
25496927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 32145945 - 32145986
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
32145945 |
ttatcccggatctattatgatgcataaactatttggaaaaaa |
32145986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 573341 - 573300
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
573341 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
573300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 42206368 - 42206409
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
42206368 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
42206409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 215
Target Start/End: Complemental strand, 30960233 - 30960169
Alignment:
| Q |
150 |
attgttgccaacaccgattgggtttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
||||||| ||| |||| ||||||| |||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
30960233 |
attgttggcaagaccggttgggtt-atcccggatctattatgatgcataaactatttgaaaaaaat |
30960169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 214
Target Start/End: Complemental strand, 16630631 - 16630602
Alignment:
| Q |
185 |
tattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16630631 |
tattatgatgcagaaactagttggaaaaaa |
16630602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 203
Target Start/End: Original strand, 6928439 - 6928496
Alignment:
| Q |
145 |
aatttattgttgccaacaccgattgggtttatcccggatctattatgatgcagaaacta |
203 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||||| |||||||||| ||||| |||||| |
|
|
| T |
6928439 |
aatttattgttgccaagaccgattgag-ttatccccgatctattattatgcataaacta |
6928496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 19559186 - 19559144
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaat |
215 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
19559186 |
ttatcctggatctattatgatgcgaaaactagttggaaaaaat |
19559144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 17272591 - 17272558
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagtt |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
17272591 |
ttatcccggatctattatgatgcaaaaactagtt |
17272558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0169 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0169
Description:
Target: scaffold0169; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 16152 - 16193
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
16152 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
16193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 26708694 - 26708653
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
26708694 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
26708653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 33495615 - 33495574
Alignment:
| Q |
173 |
ttatcccggatctattatgatgcagaaactagttggaaaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
33495615 |
ttatcccggatctattatgatgcataaactatttgaaaaaaa |
33495574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University