View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15558_low_7 (Length: 267)
Name: NF15558_low_7
Description: NF15558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15558_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 259
Target Start/End: Original strand, 54958700 - 54958936
Alignment:
| Q |
20 |
agcagttggtgagaaagggaataagagtgaatggtgttgcaccaggaccaatttggacgccagttcaaccagctactatgacttatgagaagatacagaa |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54958700 |
agcagttggtgagcaagggaataagagtgaatgctgttgctccaggaccaatttggacgccagttcaaccagctactatgccttatgagaagatacagaa |
54958799 |
T |
 |
| Q |
120 |
tttggggtcagatgtgccaatgaaacgagcaggtcagccttgtgagattgcaccttgttatttgttcttggcttctcttcaggactcttcttactttact |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54958800 |
tttggggtcagatgtgccaatgaaacgagcaggtcagccttgtgagattgcaccttgttatttattcttggcttctctacaggactcttcttactttact |
54958899 |
T |
 |
| Q |
220 |
ggtcaagtcctccatccaaatggtactgtgtgcctttgct |
259 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54958900 |
ggtcaagtcctccatccaaatgg---tgtgtgcctttgct |
54958936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University