View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15558_low_8 (Length: 250)
Name: NF15558_low_8
Description: NF15558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15558_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 46 - 213
Target Start/End: Complemental strand, 3658680 - 3658515
Alignment:
| Q |
46 |
caaaggacataaactagtatccataccacatctagatcttttttcattagtcttcaaaccatcattataaagaaggcaaaagaaaaaacattttattctt |
145 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3658680 |
caaaggacataaactagcatccataccacatctagatcttttttcattagtcttcaaaccatcattataaagaaggc-aaagaaaaaacattttattctt |
3658582 |
T |
 |
| Q |
146 |
tgaggccctcccatttgagaaaccgtttgtagaagctgatgtgataaaaatggttgatttacaacctc |
213 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
3658581 |
tgaggccctcccatttgaaaaaccgttcttagaaggtgatgtgataaaaatggttga-ttacaacctc |
3658515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 3658703 - 3658675
Alignment:
| Q |
13 |
aatatgaagggcggtttacttatcaaagg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3658703 |
aatatgaagggcggtttacttatcaaagg |
3658675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University