View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1555_high_5 (Length: 294)
Name: NF1555_high_5
Description: NF1555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1555_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 31854503 - 31854781
Alignment:
| Q |
18 |
aatagaagaactgatataaagaagtagtaattgcactaaaatttcattcactcaatagtataattacaata-----gcaatggaaatggtacataagacc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31854503 |
aatagaagaactgatataaagaagtagtaattgcactaaaatttcattcactcaatagtataattacaatatagcagcaatggaaatggtacataagacc |
31854602 |
T |
 |
| Q |
113 |
aattggaggtatgaagtacaacgggaaaattttatggactgttttcctgcgtgtctgtgacagcagaatttgcttctgttactgctgtcttgagcaggtc |
212 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31854603 |
aattgaaggtatgaagtacaacgggaatattttatggactgttttcctgcgtgtctgtgacagcagaatttgcttctgttactgctgtcttgggcaggtc |
31854702 |
T |
 |
| Q |
213 |
tgttttgt-ggggaggcagtggagattttgtttcctgtactgttttgctgtgcgatgtgttggcgggttctgtgctgct |
290 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31854703 |
tgttttgtgggggaggcagtggagattttgtttcctgtactgttttgctgtgcgatgtgttggggggttttgtgctgct |
31854781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University