View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1555_high_6 (Length: 260)
Name: NF1555_high_6
Description: NF1555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1555_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 43205121 - 43205353
Alignment:
| Q |
18 |
attttaacactcttatattcattcttttattgaatacaattttgaaaattacatgtcacacataaaatggtggaaaccatataaaagtt-gcgagaccca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43205121 |
attttaacactcttatattcattcttttattaaatagaattttgaaaattacatgtcacacataaaatggtggaaaccatataaaagtttgcgagaccca |
43205220 |
T |
 |
| Q |
117 |
agcaaatttcataaaatgagaaagtgttggaagagtcacggtagatatcacgattgatcttaataacactcaacaattataaatttcacctaatattata |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
43205221 |
agcaaatttcatgaaatgagaaagtgttggaagagtcacggtagatatcactattgatcctaataacactcaacaattataaatttcagctaataatata |
43205320 |
T |
 |
| Q |
217 |
gtgcatgtttggaatcacatcgtttagtagaat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43205321 |
gtgcatgtttggaatcacatcgtttagtagaat |
43205353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University