View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556-Insertion-21 (Length: 65)
Name: NF1556-Insertion-21
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556-Insertion-21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 38816928 - 38816975
Alignment:
| Q |
8 |
tgttgaagatcaaccaatagttttgggtcatcttctttcaccaacaaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816928 |
tgttgaagatcaaccaatagttttgggtcatcttctttcaccaacaaa |
38816975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University