View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556-Insertion-22 (Length: 54)
Name: NF1556-Insertion-22
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556-Insertion-22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-19
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 28118781 - 28118734
Alignment:
| Q |
7 |
actttcatgcagagaagaccataaacctctttcacaacaatcttcaca |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28118781 |
actttcatgcagagaagaccataaacctctttcacaacaatcttcaca |
28118734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University