View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15560_low_1 (Length: 351)
Name: NF15560_low_1
Description: NF15560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15560_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 24750144 - 24750459
Alignment:
| Q |
1 |
aactattcaccgttagtttgataagtttttggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagtaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750144 |
aactattcaccgttagtttgataagtttttggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagtaccc |
24750243 |
T |
 |
| Q |
101 |
aatattcttaacactatgtcacatgatggcatgttcaatgttaagttacattgcaatatcatggatgaaggtggtgccattgcaaacagtgagatcaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750244 |
aatattcttaacactatgtcacatgatggcatgttcaatgttaagttacattgcaatatcatggatgaaggtggtgccattgcaaacagtgagatcaagg |
24750343 |
T |
 |
| Q |
201 |
gtacaatttgtgaagatatcatcacttggacttatattttgtttgtctgtggttggagggaatatttctctaagatatcttcctgtgtcttttaatcaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750344 |
gtacaatttgtgaagatatcatcacttggacttatattttgtttgtctgtggttggagggaatatttctctaagatatcttcctgtgtcttttaatcaag |
24750443 |
T |
 |
| Q |
301 |
ctattggtgctacgac |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24750444 |
ctattggtgctacgac |
24750459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 31330236 - 31330303
Alignment:
| Q |
30 |
tggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagta |
97 |
Q |
| |
|
|||||| |||| ||||||||||| | ||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
31330236 |
tggtattcatccaacattggtgttcttctattgaacaagtatttgttaagcaactatggtttcaagta |
31330303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 31330464 - 31330513
Alignment:
| Q |
258 |
gggaatatttctctaagatatcttcctgtgtcttttaatcaagctattgg |
307 |
Q |
| |
|
||||||||||| || |||||||||||||||| |||||||| |||||||| |
|
|
| T |
31330464 |
gggaatatttcgcttcgatatcttcctgtgtcgtttaatcaggctattgg |
31330513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 313
Target Start/End: Original strand, 35016286 - 35016323
Alignment:
| Q |
276 |
tatcttcctgtgtcttttaatcaagctattggtgctac |
313 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
35016286 |
tatcttcctgtgtcgtttaatcaagctatcggtgctac |
35016323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University