View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15561_low_4 (Length: 338)

Name: NF15561_low_4
Description: NF15561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15561_low_4
NF15561_low_4
[»] chr6 (2 HSPs)
chr6 (10-183)||(24587143-24587316)
chr6 (220-338)||(24587353-24587471)


Alignment Details
Target: chr6 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 10 - 183
Target Start/End: Original strand, 24587143 - 24587316
Alignment:
10 ataattctattaatatgttgcgaactgcgaattgatacttacattatatactggttcgtagtgcttttacgaattgttttgcataaattttcgttataat 109  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
24587143 ataattctattaatatgttgtgaactgcgaattgatacttacattacatactggttcgtagtgcttttacgaattgttttgcataaattttcgttataat 24587242  T
110 tatttgaaattgtgaaccggcgaatccaattaactgaagatcaaagaaagaggaatgtctcatacaataacacc 183  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||    
24587243 tatttgaaattgtgaaccggcgaatcaaattaactgaagatcaaagaaagaggaatgtctcataaaataacacc 24587316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 220 - 338
Target Start/End: Original strand, 24587353 - 24587471
Alignment:
220 gattatgataagtggatactattaggataaattgttcttttattgtcatcggtatcaccaaaacatagaaaaatcgaaagaaagtattgtatgacaaagg 319  Q
    |||||||||||||||||||||| ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
24587353 gattatgataagtggatactataaggataaattgttcttttattgctatcggtatcaccaaaacatagaaaaatcgaaagaaagtattgtatgacaaagg 24587452  T
320 gtagcacttaggtgacata 338  Q
    |||||||||||||||||||    
24587453 gtagcacttaggtgacata 24587471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University