View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15561_low_7 (Length: 237)
Name: NF15561_low_7
Description: NF15561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15561_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 42650704 - 42650485
Alignment:
| Q |
1 |
tttttcttttgatttatcgggttctattttgtcaacaggaatcatacataacgggtttggaaaaatgctaaattgaacaattatttgaaccaacctagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42650704 |
tttttcttttgatttatcgggttctattttgtcaacaggaatcatacataacgggtttggaaaaatgctaaattgaacaattatttgaaccaacctagtt |
42650605 |
T |
|
| Q |
101 |
gttttacattgagttggtcaggtcatcaatcatcatgttgatttggacgcgtgcccaccccagctaccaattagattgatattaatttgaaggaagtgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42650604 |
gttttacattgagttggtcaggtcatcaatcatcatgttgatttggacgcgtgcccaccccagctaccaattagaatgatattaatttgaaggaagtgat |
42650505 |
T |
|
| Q |
201 |
tcttcacaaacatgtttaaa |
220 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
42650504 |
tcttcacgaacatgtttaaa |
42650485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University