View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15563_low_11 (Length: 233)
Name: NF15563_low_11
Description: NF15563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15563_low_11 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 59 - 233
Target Start/End: Complemental strand, 10163642 - 10163468
Alignment:
| Q |
59 |
cttgatctctttcaatggctctatggtttgtggtttttgcaaatatatggatgcacatggataatggagctaattataataggaaaaggaggtgtataga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10163642 |
cttgatctctttcaatggctctatggtttgtggtttttgcaaatatatagatgcacatggataatggagctaattataataggaaaaggaggtgtataga |
10163543 |
T |
 |
| Q |
159 |
aaggtaaggttggttactttggaagaagggacaagaaattgatgactagaaagcggtaaagcttagattacagaa |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10163542 |
aaggtaaggttggttactttggaaaaagggacaagaaattgatgactagaaagtggtaaagcttagattacagaa |
10163468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 10163691 - 10163658
Alignment:
| Q |
1 |
actggcccccaatctgacatcttcactcactctt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10163691 |
actggcccccaatctgacatcttcactcactctt |
10163658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University