View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15563_low_9 (Length: 247)
Name: NF15563_low_9
Description: NF15563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15563_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 49302752 - 49302521
Alignment:
| Q |
1 |
tttagccccctttctgtgattctgtcactaattgttgccaatatttgagttcctattcctattggaagccaaagttacaaatnnnnnnnntcactat-ct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
49302752 |
tttagccccctttctgtgattctgtcactaattgttaccaatatttgagttcctattcctattggaagccaaagttacaaataaaaaaaatcactatact |
49302653 |
T |
 |
| Q |
100 |
agtgtatggtatactctattatgcttagtatagattaactaatcaattttatattcaatcttctcagccatattgagtgcaaaatcatgtgaaaaacatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302652 |
agtgtatggtatactctattatgcttagtatagattaactaatcagttttatattcaatcttctcagccatattgagtgcaaaatcatgtgaaaaacatc |
49302553 |
T |
 |
| Q |
200 |
aaatcttttagccggctgattcagagtaaaat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49302552 |
aaatcttttagccggctgattcagagtaaaat |
49302521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University