View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15564_high_2 (Length: 364)
Name: NF15564_high_2
Description: NF15564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15564_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 228 - 354
Target Start/End: Complemental strand, 1619185 - 1619059
Alignment:
| Q |
228 |
gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatgatcatgctctatgc |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1619185 |
gttcagtgttgggtgatcttgacttctcatcttagatctacccactatgctatttttgcttttcttttcttaatttcattggaatgatcatgctctatgc |
1619086 |
T |
 |
| Q |
328 |
aattccattcttatacagatgatgatg |
354 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1619085 |
aattccattcttatacagatgatgatg |
1619059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 1619445 - 1619333
Alignment:
| Q |
4 |
tcaataagataggcatggagagttggaaaaatatatgatagtaaaatagagaaagagataaacaatgggattagggaaaagaacgaggtagaatgggaga |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1619445 |
tcaataagataggcatggagagttgcaaaaatatatgatagtaaaatagagaaagagataaacaatgggattagggaaaagaacgaggtagaatgggaga |
1619346 |
T |
 |
| Q |
104 |
agtaagatgaagg |
116 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1619345 |
agtaagatgaagg |
1619333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 247 - 344
Target Start/End: Complemental strand, 40387182 - 40387079
Alignment:
| Q |
247 |
tgacttctcatctta-gatctacccactatgctatttttgcttttctt---ttcttaattt-cattggaatgatcatgctctatgca--attccattctt |
339 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||||||| ||||||| || |||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
40387182 |
tgacgtctcatcttacgatctacccaccatgctatttctgctttttttctcttcttaattttcattg-aatgatcatgctctatgcaatattccattctt |
40387084 |
T |
 |
| Q |
340 |
ataca |
344 |
Q |
| |
|
||||| |
|
|
| T |
40387083 |
ataca |
40387079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University