View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15564_high_4 (Length: 296)
Name: NF15564_high_4
Description: NF15564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15564_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 31924750 - 31925038
Alignment:
| Q |
1 |
tttaggaactaactttaaacaatatataggaaaattttgccacatgacctgcaggagggtgtattggaagctatagctattcaagcactaggccaggtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924750 |
tttaggaactaactttaaacaatatacaggaaaattttgccacatgacttgcaggagggtgtattggaagctatagctattcaagcactaggccaggtac |
31924849 |
T |
|
| Q |
101 |
ttgttgatcaatctctagattaacttatgaaagcagttaattcttctagtccattttgtttattgataaaattttcatattcaaatacgtagcattctat |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31924850 |
ttgttgatcaatctatagattaacttatgaaagcagttaattcttctagtccattttgtttattgataaaattttcatattcaaata-gtagcattctat |
31924948 |
T |
|
| Q |
201 |
agatgttttggattatgaggtttattttcatttcttttgcctttttattgaaatgtatggaacaaagatccttgtatttaggtataatac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31924949 |
agatgttttggattatgaggtttattttcatttcttttgcctttttattgaaatgtatggaacaaagatccttctatttaggtataatac |
31925038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University