View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15564_low_10 (Length: 222)
Name: NF15564_low_10
Description: NF15564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15564_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 8285328 - 8285205
Alignment:
| Q |
1 |
ttacaagccaaattaaattcataaaaaacattgagacttcgcaaaacctgatgcacaagcaaagtttgtctattgaggacttttaaaaagatccaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8285328 |
ttacaagccaaattaaattcataaaaaacattgagacttcgcaaaacctgatgcacaagcaaagtttgtctattgaggacttttaaaaagatccaaagat |
8285229 |
T |
|
| Q |
101 |
gggtccttactatttttggtaacg |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8285228 |
gggtccttactatttttggtaacg |
8285205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University