View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15565_high_17 (Length: 300)
Name: NF15565_high_17
Description: NF15565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15565_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 4 - 284
Target Start/End: Complemental strand, 35049156 - 35048876
Alignment:
| Q |
4 |
aaaattaattgacgtgacggatggtggcataaaatacggtttattttgttgctaccgaattaaattaatttaatttcattaaattaatttctaaaagt-g |
102 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| | |
|
|
| T |
35049156 |
aaaattaattgacgtgacgaatggtggcataaaatacggtttattttgttgctaccgaattaaataaatttaatttaattaaattaatttctaaaagtgg |
35049057 |
T |
 |
| Q |
103 |
gaccaagaggcagaatacagaaggaccaagaagaagttaacaatttgatcagttttgagagaaaaaggtgtctatgtgtgtgnnnnnnnaaggaacaaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35049056 |
gaccaagaggcagaatacagaaggaccaagaagaagttaacaatttgatcagttttgagagaaaaaggtgtctatgtgtgtg-ttttttaaggaacaaac |
35048958 |
T |
 |
| Q |
203 |
aacgtaggtagtttcnnnnnnnnnnnnnnncaaccttatagtttgctataaaaacagaacaaaacacgtttgatgatgtttt |
284 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35048957 |
aacgtaggtagtttcaaaaaaattaaaaaacaaccttatagtttgctataaaaacagaacaaaacacgtttgatgatgtttt |
35048876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University