View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15565_low_16 (Length: 323)
Name: NF15565_low_16
Description: NF15565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15565_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 93 - 307
Target Start/End: Complemental strand, 42983056 - 42982840
Alignment:
| Q |
93 |
cgggttttgattcgggtgtgaagcttgagtctgattgcatgtatccgtttacttcttcaagtagcgttttgcagagaaaaattaaactgcaatatgatga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983056 |
cgggttttgattcgggtgtgaagcttgaatctgattgcatgtatccgtttacttcttcaagtagcgttttgcagagaaaaattaaactgcaatatgatga |
42982957 |
T |
|
| Q |
193 |
gcttgttaaaagtaatgaatccaagaaattgactctgccacaggtatttcaagtttcatagttttctat--nnnnnnnnntctgtaaattttgaattttt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42982956 |
gcttgttaaaagtaatgaatccaagaaattgactctgccacaggtatttcaagtttcatagttttctataaaaaaaaaaatctgtaaattttgaattttt |
42982857 |
T |
|
| Q |
291 |
gttaagctggtttttga |
307 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42982856 |
gttaagctggtttttga |
42982840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University