View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15565_low_20 (Length: 289)
Name: NF15565_low_20
Description: NF15565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15565_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 25558008 - 25557923
Alignment:
| Q |
10 |
ataatactgtttgattcgatagctcaaggtagatagatttcttaaggcaaaatctgaattttggaattctaacatctcattggaac |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25558008 |
ataataatgtttgattcgatagctcaaggtagatagatttcttaaggcaaaatctgaattttgggattctaacatctcattggaac |
25557923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 174 - 219
Target Start/End: Complemental strand, 25557839 - 25557794
Alignment:
| Q |
174 |
gacatgatatcataattatgcgaatcagtttgaataagcagcggat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25557839 |
gacatgatatcataattatgcgaatcagtttgaataagcagcggat |
25557794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University