View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15565_low_29 (Length: 231)
Name: NF15565_low_29
Description: NF15565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15565_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 37 - 221
Target Start/End: Complemental strand, 29457149 - 29456965
Alignment:
| Q |
37 |
tacagcagaaaaggaataatagtccacattatgatattacaatataaaacataccttgtagaaaaaatatcataatttttagtctgagcacgtattcaag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29457149 |
tacagcagaaaaggaataatagtccacattatgatattacaacataaaacataccttgtagaaaaaatatcataatttttagtctgagcacgtattcaag |
29457050 |
T |
|
| Q |
137 |
acatgatnnnnnnngggtgtttttgtgtgaaaatactttgtaggtttcttttgcgagtacaaatttatgcagtacctttgcttct |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29457049 |
acatgataaaaaaagggtgtttttgtgtgaaaatactttgtaggtttcttttgcgagtacaaatttatgcagtacctttgcttct |
29456965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 22 - 106
Target Start/End: Complemental strand, 29449218 - 29449134
Alignment:
| Q |
22 |
atggcagtcaaagtctacagcagaaaaggaataatagtccacattatgatattacaatataaaacataccttgtagaaaaaatat |
106 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||| ||||||| |||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
29449218 |
atggcattcaaagtctacagcataaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatat |
29449134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 29449109 - 29449062
Alignment:
| Q |
155 |
gtttttgtgtgaaaatactttgtaggtttcttttgcgagtacaaattt |
202 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
29449109 |
gtttttgtgtgaaaatgccttgtaggtttcttttgcaagtacatattt |
29449062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University