View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15565_low_30 (Length: 223)
Name: NF15565_low_30
Description: NF15565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15565_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 207
Target Start/End: Complemental strand, 43486816 - 43486615
Alignment:
| Q |
13 |
agatgaaccattacaacaaatactaaaacgtcaaactgaaggttcctcaacttctcgatcaaccgtcacggaaacaaacgaccaagatacttactccaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
43486816 |
agatgaaccattacaacaaatactaaaacgtcaaactgaaggttcctcaacttctcgatcaaccgtcacggaaacaaatgaccaagaaacttactccaat |
43486717 |
T |
 |
| Q |
113 |
gataggtggtt-------atgaacctatatttctattcgcaaaaattatcctcctctgtgctagaaccacatctaaaacaattcaagtctaatgaagaca |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486716 |
gataggtggttatgatttatgaacctatatttctattcgcaaaaattatcctcctctgtgctagaaccacatctaaaacaattcaagtctaatgaagaca |
43486617 |
T |
 |
| Q |
206 |
tt |
207 |
Q |
| |
|
|| |
|
|
| T |
43486616 |
tt |
43486615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University