View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15567_high_41 (Length: 210)

Name: NF15567_high_41
Description: NF15567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15567_high_41
NF15567_high_41
[»] chr8 (1 HSPs)
chr8 (44-198)||(1357252-1357406)
[»] chr6 (1 HSPs)
chr6 (97-182)||(15434983-15435066)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 44 - 198
Target Start/End: Complemental strand, 1357406 - 1357252
Alignment:
44 atctagttagtgtaaagagacacgtgtcacttgatccaataattaaggataaattgctaacagaaatggatataaaaggagaaaggatgaattatgggaa 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1357406 atctagttagtgtaaagagacacgtgtcacttgatccaataattaaggataaattgctaacagaaatggatataaaaggagaaaggatgaattatgggaa 1357307  T
144 ggcatgaaaataatatggattgaagtctctatttctccctctgaatattcatctc 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
1357306 ggcatgaaaataatatggattgaagtctctatttctccctctgaatattcttctc 1357252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 182
Target Start/End: Complemental strand, 15435066 - 15434983
Alignment:
97 ttgctaacagaaatggatataaaaggagaaaggatgaattatgggaag-gcatgaaaataatatggattgaagtctctatttctccc 182  Q
    ||||||| ||||||||||||||| ||||||||  ||||| ||| || | |||||||||||||  |||||||||||||||||||||||    
15435066 ttgctaagagaaatggatataaa-ggagaaagtctgaatgatgtgaggagcatgaaaataat--ggattgaagtctctatttctccc 15434983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University