View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15567_low_16 (Length: 359)
Name: NF15567_low_16
Description: NF15567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15567_low_16 |
 | |
|
| [»] scaffold0276 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0276 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 3 - 341
Target Start/End: Complemental strand, 11820 - 11480
Alignment:
| Q |
3 |
aggaggagcagagaaggaggatttcatgtttgtgttggaaaagcttaattctagattgcctcatggaagaataagcttctcaacaagcctggtagagttt |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11820 |
aggaagagcagagaaggaggatttcatgtttgtgttggaaaagcttaactctagattgcctcatggaagaataagcttctcaacaagcctggtagagttt |
11721 |
T |
|
| Q |
103 |
ctctcctgcctccctggcttccttagagtgtttgtcatcaatttgatatagtcacta--aacattatttggaaaggagaaattaataaaggtatttattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11720 |
ctctcctgcctccctggcttccttagagtgtttgtcatcaatttgatatagtcactataaacattatttggaaaggagaaattaataaaggtatttattt |
11621 |
T |
|
| Q |
201 |
ggttagttggaaaacatcactaaaccaaaacaaacatggaggtcttggcattagggtaactagagaggccaacatttcattgcttgagaaattggtgtgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11620 |
ggttagttggaaaacatcactaaaccaaaaaaaacatggaggtcttggcattagggtaactagagaggccaacatttcattgcttgagaaattggtgtgg |
11521 |
T |
|
| Q |
301 |
gatatcaattgtggtgctgacaagctttgggtcaacattct |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11520 |
gatatcaattgtggtgctgacaagctttgggtcaacattct |
11480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University