View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15567_low_23 (Length: 323)
Name: NF15567_low_23
Description: NF15567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15567_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 69 - 307
Target Start/End: Original strand, 29682067 - 29682305
Alignment:
| Q |
69 |
gtcatgatccggcgttggttgatctgagccacaaccaccctccgtcactccccattcgggtgaaatcggagaatggattgcggcgttggatccatcgtat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29682067 |
gtcatgatccggcgttggttgatctgagccacaaccaccctccgtcactccccattcgggtgaaaccggagaatggattgcggcgttggatccatcgtat |
29682166 |
T |
|
| Q |
169 |
gggttcgccggcgaaacggttcgtggtggccgggtcaaattatcggacctgatgatcactccacttctcatctcatttctcctcctcgttctggaactcc |
268 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29682167 |
gggttcgccggcgaaacggctcgtggtggccgggtcaaattatcggacctgatgatcactccacttctcatctcacttctcctcctcgttctggaactcc |
29682266 |
T |
|
| Q |
269 |
tgttaagcttctcggcagagaagacgctagcgtgtaact |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29682267 |
tgttaagcttctcggcagagaagacgctagcgtgtaact |
29682305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University