View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15567_low_38 (Length: 241)
Name: NF15567_low_38
Description: NF15567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15567_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 44 - 231
Target Start/End: Complemental strand, 1357406 - 1357219
Alignment:
| Q |
44 |
atctagttagtgtaaagagacacgtgtcacttgatccaataattaaggataaattgctaacagaaatggatataaaaggagaaaggatgaattatgggaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357406 |
atctagttagtgtaaagagacacgtgtcacttgatccaataattaaggataaattgctaacagaaatggatataaaaggagaaaggatgaattatgggaa |
1357307 |
T |
 |
| Q |
144 |
ggcatgaaaataatatggattgaagtctctatttctccctctgaatattcttctctgtttcttatccccttcttttgtacttctctgc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357306 |
ggcatgaaaataatatggattgaagtctctatttctccctctgaatattcttctctgtttcttatccccttcttttgtacttctctgc |
1357219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 182
Target Start/End: Complemental strand, 15435066 - 15434983
Alignment:
| Q |
97 |
ttgctaacagaaatggatataaaaggagaaaggatgaattatgggaag-gcatgaaaataatatggattgaagtctctatttctccc |
182 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| ||||| ||| || | ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15435066 |
ttgctaagagaaatggatataaa-ggagaaagtctgaatgatgtgaggagcatgaaaataat--ggattgaagtctctatttctccc |
15434983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University