View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15567_low_42 (Length: 231)
Name: NF15567_low_42
Description: NF15567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15567_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 49 - 216
Target Start/End: Original strand, 38747743 - 38747910
Alignment:
| Q |
49 |
tgaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaatcgaagaaccatagcgt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
38747743 |
tgaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaattgaagaaccgtagcgt |
38747842 |
T |
 |
| Q |
149 |
gaaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747843 |
gaaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaa |
38747910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University