View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15568_high_3 (Length: 276)
Name: NF15568_high_3
Description: NF15568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15568_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 15262738 - 15262570
Alignment:
| Q |
1 |
taaatcattgagaagctttgtaacattacttgctccaaaaattctatgaacatttgcaaatttttgtggctgatcaggtggaaaataaggtgcaaatgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15262738 |
taaatcattgagaagctttgtaacattgcttgctccaaaaattctatgaacatttgcaaatttttgtggctgatcaggtggaaaataaggtgcaaatgca |
15262639 |
T |
|
| Q |
101 |
cattctggttgacattttcggcgtagaaacttgcatgctgcacatggtgaatttgaggatgccatggta |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15262638 |
cattctggttggcattttcggcgtagaaacttgcatgctgcacatggtgaatttgaggatgccatggta |
15262570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 157
Target Start/End: Complemental strand, 591254 - 591118
Alignment:
| Q |
21 |
taacattacttgctccaaaaattctatgaacatttgcaaatttttgtggctgatcaggtggaaaataaggtgcaaa--tgcacattctggttgacatttt |
118 |
Q |
| |
|
||||||||||||| ||||| ||| | |||||||||||||| || || |||| || ||||| |||||||||||||| |||| || |||||| |||||| |
|
|
| T |
591254 |
taacattacttgcaccaaatattttgtgaacatttgcaaacttatgaggctcttctggtgggaaataaggtgcaaaaatgca-atcttggttg-catttt |
591157 |
T |
|
| Q |
119 |
cggcgtagaaacttgcatgctgcacatggtgaatttgag |
157 |
Q |
| |
|
| | |||||||||||| || |||||||| ||||||||| |
|
|
| T |
591156 |
cttcttagaaacttgcaagcagcacatggagaatttgag |
591118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 156
Target Start/End: Complemental strand, 19282025 - 19281994
Alignment:
| Q |
125 |
agaaacttgcatgctgcacatggtgaatttga |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19282025 |
agaaacttgcatgctgcacatggtgaatttga |
19281994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University