View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15568_high_4 (Length: 247)
Name: NF15568_high_4
Description: NF15568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15568_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 231
Target Start/End: Original strand, 7182368 - 7182591
Alignment:
| Q |
9 |
attattcttgatagtaattaaataaatttattgagcaaatatatatgatatctttaataaatattt-gtttaccataacttggttgctttggtatattct |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7182368 |
attattctagatagtaattaaataaatttattgagcaaatatatatgatatctttaataaatattttgtttaccataacttggttgctttggtatattct |
7182467 |
T |
 |
| Q |
108 |
cctcttttcctcttatagttaggttctttgaaaacttttgactatctcttactttcttcaaatcaagaatccctgcttcttctaatgaaaaaatggaaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7182468 |
cctcttttcctcttatagttaggttctttgaaaacttttgactatctcttactttcttcaaatcaagaatccctgcttcttctaatgaataaatggaaaa |
7182567 |
T |
 |
| Q |
208 |
tgcagtagctgctattgcagttac |
231 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7182568 |
tgcagtagctgctattgcagttac |
7182591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University