View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15568_low_11 (Length: 221)

Name: NF15568_low_11
Description: NF15568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15568_low_11
NF15568_low_11
[»] chr2 (1 HSPs)
chr2 (1-205)||(4817715-4817919)


Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 4817919 - 4817715
Alignment:
1 taataatttaagaaaatgacatatatgtgacggtgtgtgttggtatcgaacactatatatatttgataccggaacacacataattcaataagtatatgtg 100  Q
    ||||||||||||||| ||||||||||||||| |||||||||||| |||||||  ||| ||||||||||||||||||| ||||||||||| ||||||||||    
4817919 taataatttaagaaattgacatatatgtgacagtgtgtgttggtgtcgaacatgatacatatttgataccggaacacgcataattcaatgagtatatgtg 4817820  T
101 cttcatagattcatgttaaaaaatatgcgcgtaccttcaatgaactcggtcaatctggtgatgaattgggtgcgacatgtgtcacagtaaacaacacctt 200  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4817819 cttcatagattcatgttaaaaaatatgtacgtaccttcaatgaactcggtcaatctggtgatgaattgggtgcgacatgtgtcacagtaaacaacacctt 4817720  T
201 ctaca 205  Q
    |||||    
4817719 ctaca 4817715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University