View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15568_low_11 (Length: 221)
Name: NF15568_low_11
Description: NF15568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15568_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 4817919 - 4817715
Alignment:
| Q |
1 |
taataatttaagaaaatgacatatatgtgacggtgtgtgttggtatcgaacactatatatatttgataccggaacacacataattcaataagtatatgtg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||| ||||||| ||| ||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4817919 |
taataatttaagaaattgacatatatgtgacagtgtgtgttggtgtcgaacatgatacatatttgataccggaacacgcataattcaatgagtatatgtg |
4817820 |
T |
|
| Q |
101 |
cttcatagattcatgttaaaaaatatgcgcgtaccttcaatgaactcggtcaatctggtgatgaattgggtgcgacatgtgtcacagtaaacaacacctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817819 |
cttcatagattcatgttaaaaaatatgtacgtaccttcaatgaactcggtcaatctggtgatgaattgggtgcgacatgtgtcacagtaaacaacacctt |
4817720 |
T |
|
| Q |
201 |
ctaca |
205 |
Q |
| |
|
||||| |
|
|
| T |
4817719 |
ctaca |
4817715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University