View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15569_low_1 (Length: 897)
Name: NF15569_low_1
Description: NF15569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15569_low_1 |
 | |
|
| [»] chr7 (4 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 3e-50; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 712 - 897
Target Start/End: Complemental strand, 40281007 - 40280819
Alignment:
| Q |
712 |
tttcattcagtttcttgctgcctt-gccctaataagtcttactaattcagaaaagaaacaaaaccaactcagtctcagaaatgatgaaca-ccatggcga |
809 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||| ||||| ||| ||||| |||| |||||| || |
|
|
| T |
40281007 |
tttctttcagtttcttgctacctttgccctaataagtcttactgattcagaaaagaaacaaaaccaac--agtcttagagatgattaacaaccatggtga |
40280910 |
T |
|
| Q |
810 |
tgcgcttgatgatgcatcatggcttacacgctcactctaacaggcatcatcatcatcttcat---cacctaggcctccaccatttgaatac |
897 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
40280909 |
tgcgtttgatgatgcatcatggcttacacgctcactctcacagccatcatcatcatcatcatcgccacctaggcctccaccatctgaatac |
40280819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 372 - 485
Target Start/End: Complemental strand, 40282190 - 40282078
Alignment:
| Q |
372 |
aatactaacctccattcatat--actcaattgacggtcttccttttatttttcagtcaatttgtttctcttgctctatagaattaaggactgttttctga |
469 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||||||| ||||||||||| ||||||||||||||||| |||| |||||||||| |||||| ||| |
|
|
| T |
40282190 |
aatactaacctccattcctatgtactcacttgacggtcttc-ttttatttttcggtcaatttgtttctcttactctt--gaattaaggattgttttatga |
40282094 |
T |
|
| Q |
470 |
aaatataacaaatcat |
485 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40282093 |
aaatataacaaatcat |
40282078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 580 - 654
Target Start/End: Complemental strand, 40281107 - 40281031
Alignment:
| Q |
580 |
aatagaaaactaaatatcctaaattgaaggata--cagtactataaatcaaccatatccaaaaccctagctgtgaag |
654 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40281107 |
aatagaaaaccaaatatcctaactggaaggatatacagtactataaatcaaccatatccaaaaccctagttgtgaag |
40281031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 88 - 158
Target Start/End: Complemental strand, 40282425 - 40282354
Alignment:
| Q |
88 |
gcatacactctctcgttccaataactttgatct-atcattaaaccactattaatatggaaccgaatttagtt |
158 |
Q |
| |
|
|||||||||||||| || |||||| |||||||| |||||||||||||||||||||||||| || |||||||| |
|
|
| T |
40282425 |
gcatacactctctcttttcaataattttgatcttatcattaaaccactattaatatggaatcggatttagtt |
40282354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University