View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556R-Insertion-13 (Length: 107)
Name: NF1556R-Insertion-13
Description: NF1556R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556R-Insertion-13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 7739641 - 7739543
Alignment:
| Q |
9 |
aaagcgtccgagaataattgaaaagataaattacaacctataataattaaggataagtattgagaatgacacctttatagttctagtttgtactatctg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7739641 |
aaagcgtccgagaataattgaaaagataaattacaacctataataattaaggataagaattgagaatgacacctttatagttctagtttgtactatctg |
7739543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University