View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556R-Insertion-14 (Length: 177)
Name: NF1556R-Insertion-14
Description: NF1556R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556R-Insertion-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 1e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 10 - 177
Target Start/End: Complemental strand, 48801133 - 48800964
Alignment:
| Q |
10 |
tagtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaac--tagttcgcctatttctc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
48801133 |
tagtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaacattagttggcctatttctc |
48801034 |
T |
 |
| Q |
108 |
tttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801033 |
tttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgc |
48800964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University