View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556_high_10 (Length: 237)
Name: NF1556_high_10
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 4 - 221
Target Start/End: Complemental strand, 28667197 - 28666994
Alignment:
| Q |
4 |
gctagcatccttaaaattaaatcaaagaattttgtatgatcaaattgtaataaaaggataataaaattagataacaattgtacttgagtttagataaaat |
103 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28667197 |
gctagcatccttaaaattaaatcatagaattttgtatgatcaaattgtaataaatggataataaaattagataacaattgtacttgagttta-------- |
28667106 |
T |
 |
| Q |
104 |
tagataactgcaagtcgtacatttagtgcaaattttgtcaagagagattagagtctagtgtgttggatattgcagacttcaaattgcttgacaatggtta |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28667105 |
------actgcaattcgtacatttagtgcaaattttgtcaagagagattagagtctagtgtgttggatattgcagacttcaaattgcttgacaatggtta |
28667012 |
T |
 |
| Q |
204 |
aatgcagagagaatgagg |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28667011 |
aatgcagagagaatgagg |
28666994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University