View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556_high_7 (Length: 259)
Name: NF1556_high_7
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 28667251 - 28667498
Alignment:
| Q |
1 |
tacgaccatgaactcatgcctcgaacaaaattactcatatagtctagcggaagagatcagtctcccatagcataacgaagaaacaaatgttcgatctaaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28667251 |
tacgaccatgaactcgtgcctcgaacaaaattactcatatggtctagcggaagagatcagtctcccatagcataacgaacgaacaaatgttcgatctaaa |
28667350 |
T |
 |
| Q |
101 |
ctgtgagaggtgtatatatttaatgtttgatcatgccttaaacaaaattaccgcctagtagcatagaagnnnnnnnnttacaagtatacttgccttattt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
28667351 |
ctgtgagaggtgtatatatttagtgtttgatcatgcctcaaacaaaattaccgcctagtaacatagaag-aaaaaaattacaagtgtacttgccttattt |
28667449 |
T |
 |
| Q |
201 |
gttgccaaagtagcaccactaacacccattttacccaatgctttctctg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28667450 |
gttgccaaagtagcaccactaacacccatattacccaatgctttctctg |
28667498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University