View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556_low_10 (Length: 245)
Name: NF1556_low_10
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 36 - 216
Target Start/End: Original strand, 2336820 - 2337000
Alignment:
| Q |
36 |
atatttgcattttcttttctcaaatggatcccaactagtggaactctactataactatatgcaaaccccaatcgatgatggttctcgaaatttttaatct |
135 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
2336820 |
atatttgcattttcttttgtcaaatggatcccaactagtggaactctactataattatatgcaaaccccaatcgatgatggttctcgatattttcaatct |
2336919 |
T |
|
| Q |
136 |
ttgacgtatctacgaccaccactccctaaagtgacagttcttaatatcccaaatcttttatgtttcaatcaacaccattcc |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2336920 |
ttgacgtatctacgaccaccactccttaaagtgacagttcttaatatcccaaatcttttatgtttcaatcaccaccattcc |
2337000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 230
Target Start/End: Original strand, 2337029 - 2337070
Alignment:
| Q |
188 |
atcttttatgtttcaatcaacaccattccctaccgatgagagt |
230 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
2337029 |
atcttttatggtt-aatcaacaccattccctaccgatgagagt |
2337070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University