View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556_low_12 (Length: 239)
Name: NF1556_low_12
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 53 - 231
Target Start/End: Complemental strand, 48801133 - 48800953
Alignment:
| Q |
53 |
tagtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaac--tagttcgcctatttctc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
48801133 |
tagtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaacattagttggcctatttctc |
48801034 |
T |
|
| Q |
151 |
tttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcatctcact |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48801033 |
tttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctcact |
48800953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University