View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1556_low_15 (Length: 212)
Name: NF1556_low_15
Description: NF1556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1556_low_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 6 - 212
Target Start/End: Original strand, 42324621 - 42324827
Alignment:
| Q |
6 |
agtaaacagcagcaacagggagaccaagatcattctgtgaagcaaaattgcgagtgttgaagtaatcccttgaagatggtgatgctgtcactgattctct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42324621 |
agtaaacagcagcaacagggagaccaagatcattctgtgaagcaaaattgcgagtgttgaagtaatcccttgaagatggtgatgctgtcactgattctct |
42324720 |
T |
|
| Q |
106 |
attcttttgtttgaatagaacaaacacaaacctgtgtatacctatatttggctttggtatctcatagctcactacttctttccctgtgtgttttacaatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42324721 |
attcttttgtttgaatagaacaaacacaaacctgtgtatacctatatttggctttggtatctcatagctcactacttctttccctgtgtgtgatacaatt |
42324820 |
T |
|
| Q |
206 |
tcaatat |
212 |
Q |
| |
|
||||||| |
|
|
| T |
42324821 |
tcaatat |
42324827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University