View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15570_low_1 (Length: 337)
Name: NF15570_low_1
Description: NF15570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15570_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 30744237 - 30744048
Alignment:
| Q |
1 |
tgagcacaattgattgattaacactccttgatgtttagatacacacaaggaaataattttcat-aaatgtgaaatcaannnnnnnaattattaaaagatg |
99 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
30744237 |
tgagcacaattgattggttaacactccttgatgtttagatacatacaaggaattaattttcatgaaatgtgaaatcaatttttttaattattaaaagatg |
30744138 |
T |
|
| Q |
100 |
taccgactccgtaccaaattgttggttttagnnnnnnnnntttgtttaaaattataagtcgcatacaatatcaatgaaatattaatttta |
189 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30744137 |
tactgactccgtaccaaattgttggttttagaaaaaaaaaattgtctaaaattataagtcgcatacaatatcaatgaaatattaatttta |
30744048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 256 - 326
Target Start/End: Complemental strand, 30743981 - 30743911
Alignment:
| Q |
256 |
catacaattaatgaaggacaattttgtaaaatatcttactcatcccatcaattgggatccgatattcttcg |
326 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30743981 |
catacaattatggaaggacaattttgtaaaatatcttactcatcccatcaattgggatccgatattcttcg |
30743911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University