View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15571_high_3 (Length: 359)
Name: NF15571_high_3
Description: NF15571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15571_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 31 - 336
Target Start/End: Complemental strand, 6315347 - 6315042
Alignment:
| Q |
31 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6315347 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaa |
6315248 |
T |
 |
| Q |
131 |
tctccgaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
230 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315247 |
tctccaaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
6315148 |
T |
 |
| Q |
231 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatgacagtaaaaataaactctgcaca |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6315147 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatgacagtaaaaataaattctgcaca |
6315048 |
T |
 |
| Q |
331 |
tgatga |
336 |
Q |
| |
|
|||||| |
|
|
| T |
6315047 |
tgatga |
6315042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 6318236 - 6318172
Alignment:
| Q |
274 |
accattcataatcattgttgtgcagttgttgatgacagtaaaaataaa--ctctgcacatgatga |
336 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
6318236 |
accattcataatccttgttgtgcagctgttgatgacagtaaaattaaattctctccacatgatga |
6318172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University