View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15572_low_5 (Length: 258)
Name: NF15572_low_5
Description: NF15572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15572_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 21023600 - 21023831
Alignment:
| Q |
11 |
gaagaatatagtagaagaaatctttaagaaagttgcccactcta-caacaatacattatcaatactttaatatgtaaagtaaataaaattgttatataat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21023600 |
gaagaatatagtagaagaaatctttaagaaagttgcccactcaaacaacaatacattatcaatactttaatacgtaaagtaaataaaattgttatataat |
21023699 |
T |
 |
| Q |
110 |
tctacaagtattagatttacaatatcgagcatggtgggtgcgagacccattcatatcattggcccccacattagtgtattatggtgcccctttctttgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21023700 |
tctacaagtattagatttacaatatcgagcatggtgggtgcgagacccattcatatcattggcccccacattagtgtattatggtgcccccttctttgag |
21023799 |
T |
 |
| Q |
210 |
cacatatatacttgtaatgtatataagttatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
21023800 |
cacatatatacttgtaatgtatataagctatc |
21023831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University