View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15573_high_16 (Length: 272)
Name: NF15573_high_16
Description: NF15573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15573_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 13 - 184
Target Start/End: Complemental strand, 404097 - 403926
Alignment:
| Q |
13 |
aatatgattaaggtaatctcatttatttttatttgcctgaaaattattctttcattttagagctagactatgttagttaagattgaataattgagagata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
404097 |
aatatgattaaggtaatctcatttatttttatttgcctgaaaattattctttcattttagagctagactatgttagttaagattgaataatagagagata |
403998 |
T |
 |
| Q |
113 |
ttgtagccgctttgcgacctaggcacaattggccgaactttgagatcaaatattgtgtgttctttattggtg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
403997 |
ttgtagccgctttgcgacctaggcacaattggccgaactttgagatcaaatattgtgtgttctttattggtg |
403926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 403902 - 403859
Alignment:
| Q |
208 |
gaacatgattagcctgttctaacgtaatttgactatgttcaacg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
403902 |
gaacatgattagcctgttctaacgtaatttgactatgttcaacg |
403859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University