View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15573_low_5 (Length: 412)

Name: NF15573_low_5
Description: NF15573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15573_low_5
NF15573_low_5
[»] chr5 (2 HSPs)
chr5 (104-216)||(42590891-42591004)
chr5 (253-362)||(42591181-42591288)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
104 taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt 202  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| ||    
42590891 taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt 42590990  T
203 aatacaagctggtg 216  Q
    ||||||||||||||    
42590991 aatacaagctggtg 42591004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 253 - 362
Target Start/End: Original strand, 42591181 - 42591288
Alignment:
253 atgtttcgtgtacatcgttttaacaccattctatagacattatgttgaaatgtcgtagcatgaattgaaacggtggcttactatttgcgttgcaatgaaa 352  Q
    ||||||| |||| |||||||||||||||||  ||| ||| |  ||||||||| | ||||||||||| ||||  | |||||||||||| |||| |||||||    
42591181 atgtttcttgtatatcgttttaacaccattacatacacagt--gttgaaatgacctagcatgaattcaaacaatagcttactatttgtgttgaaatgaaa 42591278  T
353 ctttttctat 362  Q
    ||||||||||    
42591279 ctttttctat 42591288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University