View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15574_high_14 (Length: 244)
Name: NF15574_high_14
Description: NF15574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15574_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 34416838 - 34417054
Alignment:
| Q |
8 |
cagcacagacatatttacatccctgattttatagttctattgctaccatttatgtctcatgatatttattgctagagtctagagtttgttgcatatggtt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34416838 |
cagcgcagacatatttacatccctgattttatagttctattgctaccatttatgtctcatgatatttattgctatagtctagagtttgttgcatatggtt |
34416937 |
T |
|
| Q |
108 |
cttaataattgaatttgttttttcatgtttgtaactaaggcgtaagccttgcgtacaatatcagttaatgcgcaggatgtgtgcctttagataaatcttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34416938 |
cttaataattgaatttgttttttcatgtttgtaactaag--gtaagccttgcgtacaatatcagttaatgcgcaggatgtgtgcctttagataaatcttg |
34417035 |
T |
|
| Q |
208 |
tgtaaatttggtactgtta |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34417036 |
tgtaaatttggtactgtta |
34417054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University