View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15574_high_19 (Length: 213)
Name: NF15574_high_19
Description: NF15574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15574_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 24 - 182
Target Start/End: Original strand, 26692128 - 26692286
Alignment:
| Q |
24 |
ctagaccactcctattattgttgcttcatatttaaagtttcatatatctattttattattttctgtttgtgtatgttgcatttgattgttttgatgtata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26692128 |
ctagaccactcctattattgttgcttcatatttaaagtttcatatatctattttattattttatgtttgtgtatgttgcatttgattgttttgatgtata |
26692227 |
T |
 |
| Q |
124 |
atcccttttgaaaattttgtagactatgatttatacaaaaattaatatgtactcaattt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26692228 |
atcccttttgaaaattttgtagactatgatttatacaaaaattaatatgtactcaattt |
26692286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University